embryonic kidney cell line hek293t (ATCC)
Structured Review
Embryonic Kidney Cell Line Hek293t, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 38021 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/embryonic+kidney+cell+line+hek293t/293T/pm42215463-300-4-9
Average 99 stars, based on 38021 article reviews
Images
Related Articles
Multiple Displacement Amplification:Article Title: Fructose-1,6-bisphosphate couples glycolytic activity to cell adhesion Article Snippet: 2-Deoxyglucose (Merck) was diluted in PBS to a concentration of 1 M, stored at −20 °C and freshly diluted to a working concentration of 25 mM in each experiment. .. The following cell lines were obtained from the American Type Culture Collection (ATCC), which authenticated them via short tandem repeat profiling: the human sarcoma cell line U-2 OS (ATCC: HTB-96; female), the human Article Title: Fructose-1,6-bisphosphate couples glycolytic activity to cell adhesion. Article Snippet: 2-Deoxyglucose (Merck) was diluted in PBS to a concentration of 1 M, stored at −20 °C and freshly diluted to a working concentration of 25 mM in each experiment. .. The following cell lines were obtained from the American Type Culture Collection (ATCC), which authenticated them via short tandem repeat profiling: the human sarcoma cell line U-2 OS (ATCC: HTB-96; female), the human Plasmid Preparation:Article Title: De novo variants in MAGED1 suggest a role in intellectual disability pathogenesis. Article Snippet: .. Primers used for plasmid construction and site-directed mutagenesis Primers Forward (5’-3’) Reverse (5’-3’) MAGED 1 CDS AAAGAGGACAGCACTTCCGG CTTGACAGCACACAAGGGG A MAGED 1 Leu137P hefsTer4 ACTGGTGAGTTTAGCTGCTAA CAAGTCTGAGATGGCC GTTAGCAGCTAAACTCACCA GTGGTTGCTGCCTGGG MAGED 1 Gln311A rg TGGCAAAACCGGACAGCCAG GCAGACCCCACCAGCA CCTGGCTGTCCGGTTTTGCC AGCCTGAGGGGTTCTGC MAGED 1-Clone ATGGCCATGGAGGCCCGAATT CGGATGGCTCAGAAAATG GATCCCCGCGGCCGCGGTAC CCTCAACCCAGAAGAA Cell culture and plasmid transfection The human Mutagenesis:Article Title: De novo variants in MAGED1 suggest a role in intellectual disability pathogenesis. Article Snippet: .. Primers used for plasmid construction and site-directed mutagenesis Primers Forward (5’-3’) Reverse (5’-3’) MAGED 1 CDS AAAGAGGACAGCACTTCCGG CTTGACAGCACACAAGGGG A MAGED 1 Leu137P hefsTer4 ACTGGTGAGTTTAGCTGCTAA CAAGTCTGAGATGGCC GTTAGCAGCTAAACTCACCA GTGGTTGCTGCCTGGG MAGED 1 Gln311A rg TGGCAAAACCGGACAGCCAG GCAGACCCCACCAGCA CCTGGCTGTCCGGTTTTGCC AGCCTGAGGGGTTCTGC MAGED 1-Clone ATGGCCATGGAGGCCCGAATT CGGATGGCTCAGAAAATG GATCCCCGCGGCCGCGGTAC CCTCAACCCAGAAGAA Cell culture and plasmid transfection The human Cell Culture:Article Title: De novo variants in MAGED1 suggest a role in intellectual disability pathogenesis. Article Snippet: .. Primers used for plasmid construction and site-directed mutagenesis Primers Forward (5’-3’) Reverse (5’-3’) MAGED 1 CDS AAAGAGGACAGCACTTCCGG CTTGACAGCACACAAGGGG A MAGED 1 Leu137P hefsTer4 ACTGGTGAGTTTAGCTGCTAA CAAGTCTGAGATGGCC GTTAGCAGCTAAACTCACCA GTGGTTGCTGCCTGGG MAGED 1 Gln311A rg TGGCAAAACCGGACAGCCAG GCAGACCCCACCAGCA CCTGGCTGTCCGGTTTTGCC AGCCTGAGGGGTTCTGC MAGED 1-Clone ATGGCCATGGAGGCCCGAATT CGGATGGCTCAGAAAATG GATCCCCGCGGCCGCGGTAC CCTCAACCCAGAAGAA Cell culture and plasmid transfection The human Article Title: miRNA gene mutations commonly disrupt the proper functioning of miRNA genes Article Snippet: .. The human Article Title: HuR Promotes IRES-Driven Translation of Senecavirus A by Facilitating the Formation of Translation Initiation Complexes Article Snippet: .. The porcine cell lines Instituto Biologico-Rim Suino-2 [IBRS-2; American Type Culture Collection (ATCC; Manassas, VA, USA) CRL-1835, RRID: CVCL_4528] and porcine kidney-15 (PK-15; ATCC CCL-33, RRID: CVCL_2160), along with the human Transfection:Article Title: De novo variants in MAGED1 suggest a role in intellectual disability pathogenesis. Article Snippet: .. Primers used for plasmid construction and site-directed mutagenesis Primers Forward (5’-3’) Reverse (5’-3’) MAGED 1 CDS AAAGAGGACAGCACTTCCGG CTTGACAGCACACAAGGGG A MAGED 1 Leu137P hefsTer4 ACTGGTGAGTTTAGCTGCTAA CAAGTCTGAGATGGCC GTTAGCAGCTAAACTCACCA GTGGTTGCTGCCTGGG MAGED 1 Gln311A rg TGGCAAAACCGGACAGCCAG GCAGACCCCACCAGCA CCTGGCTGTCCGGTTTTGCC AGCCTGAGGGGTTCTGC MAGED 1-Clone ATGGCCATGGAGGCCCGAATT CGGATGGCTCAGAAAATG GATCCCCGCGGCCGCGGTAC CCTCAACCCAGAAGAA Cell culture and plasmid transfection The human Modification:Article Title: miRNA gene mutations commonly disrupt the proper functioning of miRNA genes Article Snippet: .. The human Article Title: HuR Promotes IRES-Driven Translation of Senecavirus A by Facilitating the Formation of Translation Initiation Complexes Article Snippet: .. The porcine cell lines Instituto Biologico-Rim Suino-2 [IBRS-2; American Type Culture Collection (ATCC; Manassas, VA, USA) CRL-1835, RRID: CVCL_4528] and porcine kidney-15 (PK-15; ATCC CCL-33, RRID: CVCL_2160), along with the human |


