Review



embryonic kidney cell line hek293t  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    ATCC embryonic kidney cell line hek293t
    Embryonic Kidney Cell Line Hek293t, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 38021 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/embryonic+kidney+cell+line+hek293t/293T/pm42215463-300-4-9
    Average 99 stars, based on 38021 article reviews
    embryonic kidney cell line hek293t - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Multiple Displacement Amplification:

    Article Title: Fructose-1,6-bisphosphate couples glycolytic activity to cell adhesion
    Article Snippet: 2-Deoxyglucose (Merck) was diluted in PBS to a concentration of 1 M, stored at −20 °C and freshly diluted to a working concentration of 25 mM in each experiment. .. The following cell lines were obtained from the American Type Culture Collection (ATCC), which authenticated them via short tandem repeat profiling: the human sarcoma cell line U-2 OS (ATCC: HTB-96; female), the human embryonic kidney cell line HEK293T (ATCC: CRL-3216; sex not specified), the human breast cancer cell line MDA-MB-231 (ATCC: HTB-26; female) and the telomerase-immortalized human retinal pigment epithelium cell line hTERT RPE-1 (ATTC: CRL-4000; female). ..

    Article Title: Fructose-1,6-bisphosphate couples glycolytic activity to cell adhesion.
    Article Snippet: 2-Deoxyglucose (Merck) was diluted in PBS to a concentration of 1 M, stored at −20 °C and freshly diluted to a working concentration of 25 mM in each experiment. .. The following cell lines were obtained from the American Type Culture Collection (ATCC), which authenticated them via short tandem repeat profiling: the human sarcoma cell line U-2 OS (ATCC: HTB-96; female), the human embryonic kidney cell line HEK293T (ATCC: CRL3216; sex not specified), the human breast cancer cell line MDA-MB-231 (ATCC: HTB-26; female) and the telomerase-immortalized human retinal pigment epithelium cell line hTERT RPE-1 (ATTC: CRL-4000; female). ..

    Plasmid Preparation:

    Article Title: De novo variants in MAGED1 suggest a role in intellectual disability pathogenesis.
    Article Snippet: .. Primers used for plasmid construction and site-directed mutagenesis Primers Forward (5’-3’) Reverse (5’-3’) MAGED 1 CDS AAAGAGGACAGCACTTCCGG CTTGACAGCACACAAGGGG A MAGED 1 Leu137P hefsTer4 ACTGGTGAGTTTAGCTGCTAA CAAGTCTGAGATGGCC GTTAGCAGCTAAACTCACCA GTGGTTGCTGCCTGGG MAGED 1 Gln311A rg TGGCAAAACCGGACAGCCAG GCAGACCCCACCAGCA CCTGGCTGTCCGGTTTTGCC AGCCTGAGGGGTTCTGC MAGED 1-Clone ATGGCCATGGAGGCCCGAATT CGGATGGCTCAGAAAATG GATCCCCGCGGCCGCGGTAC CCTCAACCCAGAAGAA Cell culture and plasmid transfection The human embryonic kidney cell line HEK293T (ATCC® CRL-3216TM) and cervical carcinoma-derived HeLa (ATCC® CCL-2TM) cell lines were obtained from the Cell Bank of Chinese Academy of Sciences. .. Cells were cultured in high-glucose DMEM (Gibco, Cat. No. C11995500BT) with 10% FBS (Gibco, Cat. No. 10091148) and 1% penicillin-streptomycin (Beyotime, Cat. No. C0222) at 37°C with 5% CO2.

    Mutagenesis:

    Article Title: De novo variants in MAGED1 suggest a role in intellectual disability pathogenesis.
    Article Snippet: .. Primers used for plasmid construction and site-directed mutagenesis Primers Forward (5’-3’) Reverse (5’-3’) MAGED 1 CDS AAAGAGGACAGCACTTCCGG CTTGACAGCACACAAGGGG A MAGED 1 Leu137P hefsTer4 ACTGGTGAGTTTAGCTGCTAA CAAGTCTGAGATGGCC GTTAGCAGCTAAACTCACCA GTGGTTGCTGCCTGGG MAGED 1 Gln311A rg TGGCAAAACCGGACAGCCAG GCAGACCCCACCAGCA CCTGGCTGTCCGGTTTTGCC AGCCTGAGGGGTTCTGC MAGED 1-Clone ATGGCCATGGAGGCCCGAATT CGGATGGCTCAGAAAATG GATCCCCGCGGCCGCGGTAC CCTCAACCCAGAAGAA Cell culture and plasmid transfection The human embryonic kidney cell line HEK293T (ATCC® CRL-3216TM) and cervical carcinoma-derived HeLa (ATCC® CCL-2TM) cell lines were obtained from the Cell Bank of Chinese Academy of Sciences. .. Cells were cultured in high-glucose DMEM (Gibco, Cat. No. C11995500BT) with 10% FBS (Gibco, Cat. No. 10091148) and 1% penicillin-streptomycin (Beyotime, Cat. No. C0222) at 37°C with 5% CO2.

    Cell Culture:

    Article Title: De novo variants in MAGED1 suggest a role in intellectual disability pathogenesis.
    Article Snippet: .. Primers used for plasmid construction and site-directed mutagenesis Primers Forward (5’-3’) Reverse (5’-3’) MAGED 1 CDS AAAGAGGACAGCACTTCCGG CTTGACAGCACACAAGGGG A MAGED 1 Leu137P hefsTer4 ACTGGTGAGTTTAGCTGCTAA CAAGTCTGAGATGGCC GTTAGCAGCTAAACTCACCA GTGGTTGCTGCCTGGG MAGED 1 Gln311A rg TGGCAAAACCGGACAGCCAG GCAGACCCCACCAGCA CCTGGCTGTCCGGTTTTGCC AGCCTGAGGGGTTCTGC MAGED 1-Clone ATGGCCATGGAGGCCCGAATT CGGATGGCTCAGAAAATG GATCCCCGCGGCCGCGGTAC CCTCAACCCAGAAGAA Cell culture and plasmid transfection The human embryonic kidney cell line HEK293T (ATCC® CRL-3216TM) and cervical carcinoma-derived HeLa (ATCC® CCL-2TM) cell lines were obtained from the Cell Bank of Chinese Academy of Sciences. .. Cells were cultured in high-glucose DMEM (Gibco, Cat. No. C11995500BT) with 10% FBS (Gibco, Cat. No. 10091148) and 1% penicillin-streptomycin (Beyotime, Cat. No. C0222) at 37°C with 5% CO2.

    Article Title: miRNA gene mutations commonly disrupt the proper functioning of miRNA genes
    Article Snippet: .. The human embryonic kidney cell line HEK293T (no. CRL-3216, American Type Culture Collection, Manassas, VA) was cultured in high-glucose Dulbecco’s modified Eagle’s medium (no. 11960044, Gibco, Carlsbad, CA) supplemented with 10% fetal bovine serum (no. 10500064, Gibco), 1% GlutaMAX (no. 35050038, Gibco), and 1% antibiotic-antimycotic (no. 15240062, Gibco). .. Cells were transfected with plasmids pCDH-CMV-MCS-EF1α-GreenPuro (no. CD513B-1, SBI, Palo Alto, CA) encoding wild-type and mutant precursors of MIR142 and MIR205 , defined as sequences encoding pre-miRNAs (on the basis of miRBase) extended by immediately adjacent 25-nt flanking sequences.

    Article Title: HuR Promotes IRES-Driven Translation of Senecavirus A by Facilitating the Formation of Translation Initiation Complexes
    Article Snippet: .. The porcine cell lines Instituto Biologico-Rim Suino-2 [IBRS-2; American Type Culture Collection (ATCC; Manassas, VA, USA) CRL-1835, RRID: CVCL_4528] and porcine kidney-15 (PK-15; ATCC CCL-33, RRID: CVCL_2160), along with the human embryonic kidney cell line HEK293T (ATCC CRL-11268, RRID: CVCL_1926), were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM; Solarbio, Beijing, China, Cat. No. 12100) supplemented with 10% fetal bovine serum (FBS; Gibco, Grand Island, NY, USA, Cat. No. 30044333) and antibiotic–antimycotic solution (100 U/mL penicillin and 100 μg/mL streptomycin; Solarbio, Beijing, China, Cat. No. P1400). ..

    Transfection:

    Article Title: De novo variants in MAGED1 suggest a role in intellectual disability pathogenesis.
    Article Snippet: .. Primers used for plasmid construction and site-directed mutagenesis Primers Forward (5’-3’) Reverse (5’-3’) MAGED 1 CDS AAAGAGGACAGCACTTCCGG CTTGACAGCACACAAGGGG A MAGED 1 Leu137P hefsTer4 ACTGGTGAGTTTAGCTGCTAA CAAGTCTGAGATGGCC GTTAGCAGCTAAACTCACCA GTGGTTGCTGCCTGGG MAGED 1 Gln311A rg TGGCAAAACCGGACAGCCAG GCAGACCCCACCAGCA CCTGGCTGTCCGGTTTTGCC AGCCTGAGGGGTTCTGC MAGED 1-Clone ATGGCCATGGAGGCCCGAATT CGGATGGCTCAGAAAATG GATCCCCGCGGCCGCGGTAC CCTCAACCCAGAAGAA Cell culture and plasmid transfection The human embryonic kidney cell line HEK293T (ATCC® CRL-3216TM) and cervical carcinoma-derived HeLa (ATCC® CCL-2TM) cell lines were obtained from the Cell Bank of Chinese Academy of Sciences. .. Cells were cultured in high-glucose DMEM (Gibco, Cat. No. C11995500BT) with 10% FBS (Gibco, Cat. No. 10091148) and 1% penicillin-streptomycin (Beyotime, Cat. No. C0222) at 37°C with 5% CO2.

    Modification:

    Article Title: miRNA gene mutations commonly disrupt the proper functioning of miRNA genes
    Article Snippet: .. The human embryonic kidney cell line HEK293T (no. CRL-3216, American Type Culture Collection, Manassas, VA) was cultured in high-glucose Dulbecco’s modified Eagle’s medium (no. 11960044, Gibco, Carlsbad, CA) supplemented with 10% fetal bovine serum (no. 10500064, Gibco), 1% GlutaMAX (no. 35050038, Gibco), and 1% antibiotic-antimycotic (no. 15240062, Gibco). .. Cells were transfected with plasmids pCDH-CMV-MCS-EF1α-GreenPuro (no. CD513B-1, SBI, Palo Alto, CA) encoding wild-type and mutant precursors of MIR142 and MIR205 , defined as sequences encoding pre-miRNAs (on the basis of miRBase) extended by immediately adjacent 25-nt flanking sequences.

    Article Title: HuR Promotes IRES-Driven Translation of Senecavirus A by Facilitating the Formation of Translation Initiation Complexes
    Article Snippet: .. The porcine cell lines Instituto Biologico-Rim Suino-2 [IBRS-2; American Type Culture Collection (ATCC; Manassas, VA, USA) CRL-1835, RRID: CVCL_4528] and porcine kidney-15 (PK-15; ATCC CCL-33, RRID: CVCL_2160), along with the human embryonic kidney cell line HEK293T (ATCC CRL-11268, RRID: CVCL_1926), were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM; Solarbio, Beijing, China, Cat. No. 12100) supplemented with 10% fetal bovine serum (FBS; Gibco, Grand Island, NY, USA, Cat. No. 30044333) and antibiotic–antimycotic solution (100 U/mL penicillin and 100 μg/mL streptomycin; Solarbio, Beijing, China, Cat. No. P1400). ..



    Similar Products

    99
    ATCC embryonic kidney cell line hek293t
    Embryonic Kidney Cell Line Hek293t, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/embryonic+kidney+cell+line+hek293t/293T/pm42215463-300-4-9
    Average 99 stars, based on 1 article reviews
    embryonic kidney cell line hek293t - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    86
    Procell Inc embryonic kidney 293t hek293t cell line
    Embryonic Kidney 293t Hek293t Cell Line, supplied by Procell Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/embryonic+kidney+cell+line+hek293t/cells+hek293t/pm42297769-56-10-19
    Average 86 stars, based on 1 article reviews
    embryonic kidney 293t hek293t cell line - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Procell Inc human embryonic kidney cell line hek293t
    Identification of the ubiquitination site on RIG-I targeted by FGF8. (a) diagram illustrating the truncated constructs of RIG-I. (b) HEK-293T cells were co-transfected with specified plasmids and exposed to MG132 for 6 hours. Western blot analysis was conducted to assess the ubiquitination of various RIG-I truncation constructs. (C) Western blot analysis identified the ubiquitination site on RIG-I targeted by FGF8, and band intensities were quantified by densitometry to assess the degradation of each mutant. (d) a dual-luciferase assay was conducted in <t>HEK293T</t> cells co-transfected with specified RIG-I mutants and FGF8 to evaluate the impact of FGF8 on IFN-β promoter activity. Error bars indicate the mean ± SEM from three independent experiments. Two-tailed unpaired Student’s t-tests were used. ns (not significant), * p < 0.05, ** p < 0.01, and *** p < 0.001.
    Human Embryonic Kidney Cell Line Hek293t, supplied by Procell Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/embryonic+kidney+cell+line+hek293t/cells+hek293t/pmc13203027-55-18-24
    Average 86 stars, based on 1 article reviews
    human embryonic kidney cell line hek293t - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    99
    ATCC human embryonic kidney cell line hek293t
    Identification of the ubiquitination site on RIG-I targeted by FGF8. (a) diagram illustrating the truncated constructs of RIG-I. (b) HEK-293T cells were co-transfected with specified plasmids and exposed to MG132 for 6 hours. Western blot analysis was conducted to assess the ubiquitination of various RIG-I truncation constructs. (C) Western blot analysis identified the ubiquitination site on RIG-I targeted by FGF8, and band intensities were quantified by densitometry to assess the degradation of each mutant. (d) a dual-luciferase assay was conducted in <t>HEK293T</t> cells co-transfected with specified RIG-I mutants and FGF8 to evaluate the impact of FGF8 on IFN-β promoter activity. Error bars indicate the mean ± SEM from three independent experiments. Two-tailed unpaired Student’s t-tests were used. ns (not significant), * p < 0.05, ** p < 0.01, and *** p < 0.001.
    Human Embryonic Kidney Cell Line Hek293t, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/embryonic+kidney+cell+line+hek293t/293T/pm42120407-428-9-15
    Average 99 stars, based on 1 article reviews
    human embryonic kidney cell line hek293t - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    ATCC human embryonic kidney 293t hek293t cell lines
    SMURF2 prohibits the stress-mediated formation of ub + /p62 + aggresomes. (A and B) LN229 cells were transfected with HA or HA-SMURF2 and treated with DMSO; MG132 (10 μM, 12 h); H 2 O 2 (200 μM, 2 h); or LPS (100 ng/mL, 12 h). Representative immunofluorescence (IF) images of the colocalization of ub and p62. Nuclei stained with DAPI (A). Quantification the percentage of cells with ub + /p62 + puncta (B). (C – E) <t>HEK293T</t> cells were transfected with HA or HA-SMURF2 and subsequently treated with MG132 (10 μM, 12 h) or H 2 O 2 (200 μM, 2 h). Detergent-soluble and detergent-insoluble fractions were analyzed by western blotting with indicated antibodies (C and D). Quantification of the relative intensity of ub and p62 levels in the detergent-insoluble fractions shown in C and D (E). (F) LN229 cells were transfected with HA or HA-SMURF2 and treated with DMSO; MG132 (10 μM, 12 h); H 2 O 2 (200 μM, 2 h); or LPS (100 ng/mL, 12 h). Representative IF images of the colocalization of Proteostat and p62. Nuclei stained with DAPI. (G) The proposed model suggests that SMURF2 inhibits the formation of ub + /p62 + aggresomes/ALIS under stress conditions. Data were presented as the mean ± SD from three independent experiments. NS: not significant, ∗∗ p < 0.01, ∗∗∗ p < 0.001. Scale bar: 10 μm. Short Exp: short exposure; Long Exp: long exposure.
    Human Embryonic Kidney 293t Hek293t Cell Lines, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/embryonic+kidney+cell+line+hek293t/293T/pmc13084320-44-7-18
    Average 99 stars, based on 1 article reviews
    human embryonic kidney 293t hek293t cell lines - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    ATCC human embryonic kidney 293t hek293t cell line
    The DRL shows neurodevelopmental enhancer activity (A) Schematic representation of the DRL/FragT sequence in DAB1 -antisense strand. The zoom-in box (pale brown box) shows the (AAAAT) n (blue box) in the middle A-rich region of the AluJb element with left (LM) and right (RM) monomers, close to the CpG island (yellow box) and the TFBS (green box), flanked by CTCF-binding sites. The ENCODE-annotated regulatory EH38E1350977 element is represented in pink. Lines underneath represent the sequences cloned for the zebrafish transgenic lines generation, across and within the DRL sequence. (B) Stereomicroscopic images of EGFP expression in the eye and whole brain, at 24 hpf, in transgenic lines with FragT14-AS and Frag3-AS sequences cloned upstream of a promoter-less EGFP; no expression is seen in control embryos; images were processed with the Fiji software. (C) Left: representative confocal images confirming FragT14-AS and Frag3-AS expression in the eye, forebrain, midbrain, and hindbrain in these zebrafish transgenic lines at 24 hpf; maximum intensity z-projections of 14 planes; scale bars: 100 μm. Right: zoom-in images for the same zebrafish lines; orange and yellow delimitations represent eye and midbrain-hindbrain boundary close-ups, respectively; scale bars: 100 μm. (D) Left: schematic representation of the DRL sequences cloned upstream of promoter-less firefly luciferase ( luc+ ) for reporter assays in human <t>HEK293T</t> cells. Right: graphic representation of luciferase activity (fold change) for each sequence, as luc+/NanoLuc (Nluc) expression ratios in HEK293T cells, compared to the negative control (data are from three biological replicates, shown as the mean ± SD; one-way ANOVA test with Dunnett’s post hoc test; ∗∗∗∗ p < 0.0001 and ∗∗∗ p < 0.001). FB, forebrain; MB, midbrain; HD, hindbrain; OV, optic vesicle; MA, mutant allele; scale bars: 100 μm. Asterisks represent autofluorescence regions. See also .
    Human Embryonic Kidney 293t Hek293t Cell Line, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/embryonic+kidney+cell+line+hek293t/293T/pmc13125401-182-0-8
    Average 99 stars, based on 1 article reviews
    human embryonic kidney 293t hek293t cell line - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    Identification of the ubiquitination site on RIG-I targeted by FGF8. (a) diagram illustrating the truncated constructs of RIG-I. (b) HEK-293T cells were co-transfected with specified plasmids and exposed to MG132 for 6 hours. Western blot analysis was conducted to assess the ubiquitination of various RIG-I truncation constructs. (C) Western blot analysis identified the ubiquitination site on RIG-I targeted by FGF8, and band intensities were quantified by densitometry to assess the degradation of each mutant. (d) a dual-luciferase assay was conducted in HEK293T cells co-transfected with specified RIG-I mutants and FGF8 to evaluate the impact of FGF8 on IFN-β promoter activity. Error bars indicate the mean ± SEM from three independent experiments. Two-tailed unpaired Student’s t-tests were used. ns (not significant), * p < 0.05, ** p < 0.01, and *** p < 0.001.

    Journal: Virulence

    Article Title: FGF8-mediated TRIM16 regulation promotes K48-linked ubiquitination and degradation of RIG-I to facilitate Influenza a virus immune evasion

    doi: 10.1080/21505594.2026.2677346

    Figure Lengend Snippet: Identification of the ubiquitination site on RIG-I targeted by FGF8. (a) diagram illustrating the truncated constructs of RIG-I. (b) HEK-293T cells were co-transfected with specified plasmids and exposed to MG132 for 6 hours. Western blot analysis was conducted to assess the ubiquitination of various RIG-I truncation constructs. (C) Western blot analysis identified the ubiquitination site on RIG-I targeted by FGF8, and band intensities were quantified by densitometry to assess the degradation of each mutant. (d) a dual-luciferase assay was conducted in HEK293T cells co-transfected with specified RIG-I mutants and FGF8 to evaluate the impact of FGF8 on IFN-β promoter activity. Error bars indicate the mean ± SEM from three independent experiments. Two-tailed unpaired Student’s t-tests were used. ns (not significant), * p < 0.05, ** p < 0.01, and *** p < 0.001.

    Article Snippet: Human lung adenocarcinoma cell line A549 (Procell Life Science & Technology Co., Ltd., Wuhan, China; Cat. No. CL-0016), human embryonic kidney cell line HEK293T (Procell Life Science & Technology Co., Ltd., Wuhan, China; Cat. No. CL-0005), and Madin-Darby canine kidney cell line MDCK (Procell Life Science & Technology Co., Ltd., Wuhan, China; Cat. No. CL-0154) were used for virus infection experiments, protein interaction validation experiments, and virus titration assays, respectively.

    Techniques: Ubiquitin Proteomics, Construct, Transfection, Western Blot, Mutagenesis, Luciferase, Activity Assay, Two Tailed Test

    SMURF2 prohibits the stress-mediated formation of ub + /p62 + aggresomes. (A and B) LN229 cells were transfected with HA or HA-SMURF2 and treated with DMSO; MG132 (10 μM, 12 h); H 2 O 2 (200 μM, 2 h); or LPS (100 ng/mL, 12 h). Representative immunofluorescence (IF) images of the colocalization of ub and p62. Nuclei stained with DAPI (A). Quantification the percentage of cells with ub + /p62 + puncta (B). (C – E) HEK293T cells were transfected with HA or HA-SMURF2 and subsequently treated with MG132 (10 μM, 12 h) or H 2 O 2 (200 μM, 2 h). Detergent-soluble and detergent-insoluble fractions were analyzed by western blotting with indicated antibodies (C and D). Quantification of the relative intensity of ub and p62 levels in the detergent-insoluble fractions shown in C and D (E). (F) LN229 cells were transfected with HA or HA-SMURF2 and treated with DMSO; MG132 (10 μM, 12 h); H 2 O 2 (200 μM, 2 h); or LPS (100 ng/mL, 12 h). Representative IF images of the colocalization of Proteostat and p62. Nuclei stained with DAPI. (G) The proposed model suggests that SMURF2 inhibits the formation of ub + /p62 + aggresomes/ALIS under stress conditions. Data were presented as the mean ± SD from three independent experiments. NS: not significant, ∗∗ p < 0.01, ∗∗∗ p < 0.001. Scale bar: 10 μm. Short Exp: short exposure; Long Exp: long exposure.

    Journal: Redox Biology

    Article Title: SMURF2 attenuates NRF2-driven tumor progression by acting as a nuclear brake on NRF2 during cellular stress

    doi: 10.1016/j.redox.2026.104102

    Figure Lengend Snippet: SMURF2 prohibits the stress-mediated formation of ub + /p62 + aggresomes. (A and B) LN229 cells were transfected with HA or HA-SMURF2 and treated with DMSO; MG132 (10 μM, 12 h); H 2 O 2 (200 μM, 2 h); or LPS (100 ng/mL, 12 h). Representative immunofluorescence (IF) images of the colocalization of ub and p62. Nuclei stained with DAPI (A). Quantification the percentage of cells with ub + /p62 + puncta (B). (C – E) HEK293T cells were transfected with HA or HA-SMURF2 and subsequently treated with MG132 (10 μM, 12 h) or H 2 O 2 (200 μM, 2 h). Detergent-soluble and detergent-insoluble fractions were analyzed by western blotting with indicated antibodies (C and D). Quantification of the relative intensity of ub and p62 levels in the detergent-insoluble fractions shown in C and D (E). (F) LN229 cells were transfected with HA or HA-SMURF2 and treated with DMSO; MG132 (10 μM, 12 h); H 2 O 2 (200 μM, 2 h); or LPS (100 ng/mL, 12 h). Representative IF images of the colocalization of Proteostat and p62. Nuclei stained with DAPI. (G) The proposed model suggests that SMURF2 inhibits the formation of ub + /p62 + aggresomes/ALIS under stress conditions. Data were presented as the mean ± SD from three independent experiments. NS: not significant, ∗∗ p < 0.01, ∗∗∗ p < 0.001. Scale bar: 10 μm. Short Exp: short exposure; Long Exp: long exposure.

    Article Snippet: The human glioblastoma cell lines LN229 and human embryonic kidney 293T (HEK293T) cell lines were purchased from the American Type Culture Collection (ATCC).

    Techniques: Transfection, Immunofluorescence, Staining, Western Blot

    SMURF2 promotes NRF2 proteasomal degradation in response to cellular stress. (A) Co-immunoprecipitation (Co-IP) assay was performed to analyze the interaction between SMURF2 and NRF2. (B) Co-IP assay analysis of the interaction between HA-SMURF2 and His-Flag-NRF2 after treated with or without H 2 O 2 (200 μM, 2 h) (C) Endogenous co-IP assay analysis of the interaction between endogenous SMURF2 and NRF2 in HEK293T cells after treated with or without H 2 O 2 (200 μM, 2 h). (D and E) Co-IP assay analysis of the interaction between His-Flag-SMURF2 constructs (WT, C2, WW3 and ΔHECT) and Myc-NRF2 (D); the interaction between GST-SMURF2 constructs (ΔC2 and ΔWW3) and HA-NRF2 (E). (F) Co-IP assay analysis of the interaction between His-Flag-NRF2 constructs (WT and ΔNeh1-6) and HA-SMURF2. (G) Schematic diagram of mapping the direct interaction between SMURF2 and NRF2. (H) HEK293T cells expressing Flag-NRF2 were treated with MG132 (10 μM,12 h). The ubiquitination of Flag-NRF2 in the presence of purified GST or GST-SMURF2 was then detected by western blotting. (I) HEK293T cells were transfected with SMURF2 siRNA or scramble siRNA for 48 h, then transfected with HA-NRF2 and restored with Flag-SMURF2-WT/CS/CS C716A , treated with MG132 (10 μM, 12 h). Ubiquitination of HA-NRF2 was assessed by co-IP after SMURF2 knockdown and functional restoration. (J) HEK293T cells expressing HA-NRF2 and Flag-Ub-K48 or Flag-Ub-K63. The K48-linked or K63-linked ubiquitination of HA-NRF2 in the presence of purified GST or GST-SMURF2 was then detected by western blotting. (K) HEK293T cells were transfected with either HA or HA-SMURF2, then treated with DMSO, MG132 (10 μM, 12 h) or Bafilomycin A1 (Baf-A1, 100 nM, 6 h) and analyzed by western blotting of whole cell lysates (WCL) using the indicated antibodies. (L – O) HEK293T cells were transfected either with HA or HA-SMURF2 (L), or with SMURF2 siRNA or scramble siRNA oligos for 48 h (N), then treated with cycloheximide (CHX, 100 μg/mL) for the indicated times and analyzed by western blotting using the indicated antibodies. Quantification of the relative intensity of NRF2 is shown (M, O). (P) HEK293T cells were transfected with either Flag or Flag-SMURF2, then treated with PBS, H 2 O 2 (200 μM, 2 h), or LPS (100 ng/mL, 12 h) and analyzed by western blotting using the indicated antibodies. (Q) HEK293T cells were transfected with either HA or HA-SMURF2, then treated with PBS or LPS (100 ng/mL, 12 h) and analyzed by qRT-PCR using primers specific for indicated genes. The fold change in expression in HA-SMURF2 overexpressing samples was calculated relative to control samples. (R) HEK293T cells were transfected with SMURF2 siRNA or scramble siRNA oligos for 48 h, then treated with PBS, H 2 O 2 (200 μM, 2 h), or LPS (100 ng/mL, 12 h) and analyzed by western blotting using the indicated antibodies. (S) HEK293T cells were transfected with SMURF2 siRNA or scramble siRNA oligos for 48 h, then treated with PBS or LPS (100 ng/mL, 12 h) and analyzed by qRT-PCR using primers specific for indicated genes. The fold change in expression in si-SMURF2 samples was calculated relative to control samples. Data were presented as the mean ± SD from three independent experiments. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001.

    Journal: Redox Biology

    Article Title: SMURF2 attenuates NRF2-driven tumor progression by acting as a nuclear brake on NRF2 during cellular stress

    doi: 10.1016/j.redox.2026.104102

    Figure Lengend Snippet: SMURF2 promotes NRF2 proteasomal degradation in response to cellular stress. (A) Co-immunoprecipitation (Co-IP) assay was performed to analyze the interaction between SMURF2 and NRF2. (B) Co-IP assay analysis of the interaction between HA-SMURF2 and His-Flag-NRF2 after treated with or without H 2 O 2 (200 μM, 2 h) (C) Endogenous co-IP assay analysis of the interaction between endogenous SMURF2 and NRF2 in HEK293T cells after treated with or without H 2 O 2 (200 μM, 2 h). (D and E) Co-IP assay analysis of the interaction between His-Flag-SMURF2 constructs (WT, C2, WW3 and ΔHECT) and Myc-NRF2 (D); the interaction between GST-SMURF2 constructs (ΔC2 and ΔWW3) and HA-NRF2 (E). (F) Co-IP assay analysis of the interaction between His-Flag-NRF2 constructs (WT and ΔNeh1-6) and HA-SMURF2. (G) Schematic diagram of mapping the direct interaction between SMURF2 and NRF2. (H) HEK293T cells expressing Flag-NRF2 were treated with MG132 (10 μM,12 h). The ubiquitination of Flag-NRF2 in the presence of purified GST or GST-SMURF2 was then detected by western blotting. (I) HEK293T cells were transfected with SMURF2 siRNA or scramble siRNA for 48 h, then transfected with HA-NRF2 and restored with Flag-SMURF2-WT/CS/CS C716A , treated with MG132 (10 μM, 12 h). Ubiquitination of HA-NRF2 was assessed by co-IP after SMURF2 knockdown and functional restoration. (J) HEK293T cells expressing HA-NRF2 and Flag-Ub-K48 or Flag-Ub-K63. The K48-linked or K63-linked ubiquitination of HA-NRF2 in the presence of purified GST or GST-SMURF2 was then detected by western blotting. (K) HEK293T cells were transfected with either HA or HA-SMURF2, then treated with DMSO, MG132 (10 μM, 12 h) or Bafilomycin A1 (Baf-A1, 100 nM, 6 h) and analyzed by western blotting of whole cell lysates (WCL) using the indicated antibodies. (L – O) HEK293T cells were transfected either with HA or HA-SMURF2 (L), or with SMURF2 siRNA or scramble siRNA oligos for 48 h (N), then treated with cycloheximide (CHX, 100 μg/mL) for the indicated times and analyzed by western blotting using the indicated antibodies. Quantification of the relative intensity of NRF2 is shown (M, O). (P) HEK293T cells were transfected with either Flag or Flag-SMURF2, then treated with PBS, H 2 O 2 (200 μM, 2 h), or LPS (100 ng/mL, 12 h) and analyzed by western blotting using the indicated antibodies. (Q) HEK293T cells were transfected with either HA or HA-SMURF2, then treated with PBS or LPS (100 ng/mL, 12 h) and analyzed by qRT-PCR using primers specific for indicated genes. The fold change in expression in HA-SMURF2 overexpressing samples was calculated relative to control samples. (R) HEK293T cells were transfected with SMURF2 siRNA or scramble siRNA oligos for 48 h, then treated with PBS, H 2 O 2 (200 μM, 2 h), or LPS (100 ng/mL, 12 h) and analyzed by western blotting using the indicated antibodies. (S) HEK293T cells were transfected with SMURF2 siRNA or scramble siRNA oligos for 48 h, then treated with PBS or LPS (100 ng/mL, 12 h) and analyzed by qRT-PCR using primers specific for indicated genes. The fold change in expression in si-SMURF2 samples was calculated relative to control samples. Data were presented as the mean ± SD from three independent experiments. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001.

    Article Snippet: The human glioblastoma cell lines LN229 and human embryonic kidney 293T (HEK293T) cell lines were purchased from the American Type Culture Collection (ATCC).

    Techniques: Co-Immunoprecipitation Assay, Construct, Expressing, Ubiquitin Proteomics, Purification, Western Blot, Transfection, Knockdown, Functional Assay, Quantitative RT-PCR, Control

    SMURF2 nuclear translocation facilitates the degradation of NRF2 within the nucleus. (A and B) HEK293T cells were first transfected with HA-NRF2-WT. Subsequently, cells were transfected either with Flag or Flag-SMURF2 (A), or with SMURF2 siRNA or scrambled siRNA oligos for 48 h (B). Cells were then treated with H 2 O 2 (200 μM, 2 h) or LPS (100 ng/mL, 12 h). Following treatment, subcellular fractionation was performed to isolate total, nuclear, and cytoplasmic proteins, followed by western blot analysis with indicated antibodies. (C and D) LN229 cells were transfected with HA-SMURF2, then treated with PBS, H 2 O 2 (200 μM, 2 h) (C) or LPS (100 ng/mL, 12 h) (D). Representative IF images showing the subcellular localization of HA-SMURF2 are presented; nuclei were stained with DAPI. (E and F) HEK293T cells were treated with PBS, H 2 O 2 (200 μM, 2 h) (E), or LPS (100 ng/mL, 12 h) (F). Subcellular fractionation was performed to isolate total, nuclear, and cytoplasmic proteins, followed by western blot analysis with indicated antibodies. (G) Schematic depiction of NRF2 NLS1/2−Mut , NRF2 NES1/2−Mut , and SMURF2 NLS−Mut . (H–K) HEK293T cells were first transfected with HA-NRF2 NLS2−Mut (H and I) or HA-NRF2 NES2−Mut (J and K). Subsequently, cells were transfected either with Flag or Flag-SMURF2, then treated with H 2 O 2 (200 μM, 2 h) (H and J) or LPS (100 ng/mL, 12 h) (I and K). Following treatment, subcellular fractionation was performed to isolate total, nuclear, and cytoplasmic proteins, followed by western blot analysis with indicated antibodies. (L) Schematic of SMURF2 domains with NLS indicated (single-letter code). SMURF2 NLS−Mut denotes deletion of NLS residues (Top). LN229 cells transfected with Flag-SMURF2-WT or Flag-SMURF2 NLS−Mut were treated with DMSO, MG132 (10 μM, 12 h), H 2 O 2 (200 μM, 2 h), or LPS (100 ng/mL, 12 h). Representative IF images showing subcellular localization of Flag-SMURF2 or Flag-SMURF2 NLS−Mut ; nuclei were stained with DAPI (Bottom). (M) HEK293T cells were first transfected with HA-NRF2-WT. Subsequently, cells were transfected either with Flag or Flag-SMURF2 NLS−Mut , then treated with H 2 O 2 (200 μM, 2 h) or LPS (100 ng/mL, 12 h). Following treatment, subcellular fractionation was performed to isolate total, nuclear, and cytoplasmic proteins, followed by western blot analysis with indicated antibodies. (N) The proposed model indicates that SMURF2 specifically degrades NRF2 in the nucleus. Scale bar: 5 μm, Scale bar: 10 μm. Data were presented in three independent experiments.

    Journal: Redox Biology

    Article Title: SMURF2 attenuates NRF2-driven tumor progression by acting as a nuclear brake on NRF2 during cellular stress

    doi: 10.1016/j.redox.2026.104102

    Figure Lengend Snippet: SMURF2 nuclear translocation facilitates the degradation of NRF2 within the nucleus. (A and B) HEK293T cells were first transfected with HA-NRF2-WT. Subsequently, cells were transfected either with Flag or Flag-SMURF2 (A), or with SMURF2 siRNA or scrambled siRNA oligos for 48 h (B). Cells were then treated with H 2 O 2 (200 μM, 2 h) or LPS (100 ng/mL, 12 h). Following treatment, subcellular fractionation was performed to isolate total, nuclear, and cytoplasmic proteins, followed by western blot analysis with indicated antibodies. (C and D) LN229 cells were transfected with HA-SMURF2, then treated with PBS, H 2 O 2 (200 μM, 2 h) (C) or LPS (100 ng/mL, 12 h) (D). Representative IF images showing the subcellular localization of HA-SMURF2 are presented; nuclei were stained with DAPI. (E and F) HEK293T cells were treated with PBS, H 2 O 2 (200 μM, 2 h) (E), or LPS (100 ng/mL, 12 h) (F). Subcellular fractionation was performed to isolate total, nuclear, and cytoplasmic proteins, followed by western blot analysis with indicated antibodies. (G) Schematic depiction of NRF2 NLS1/2−Mut , NRF2 NES1/2−Mut , and SMURF2 NLS−Mut . (H–K) HEK293T cells were first transfected with HA-NRF2 NLS2−Mut (H and I) or HA-NRF2 NES2−Mut (J and K). Subsequently, cells were transfected either with Flag or Flag-SMURF2, then treated with H 2 O 2 (200 μM, 2 h) (H and J) or LPS (100 ng/mL, 12 h) (I and K). Following treatment, subcellular fractionation was performed to isolate total, nuclear, and cytoplasmic proteins, followed by western blot analysis with indicated antibodies. (L) Schematic of SMURF2 domains with NLS indicated (single-letter code). SMURF2 NLS−Mut denotes deletion of NLS residues (Top). LN229 cells transfected with Flag-SMURF2-WT or Flag-SMURF2 NLS−Mut were treated with DMSO, MG132 (10 μM, 12 h), H 2 O 2 (200 μM, 2 h), or LPS (100 ng/mL, 12 h). Representative IF images showing subcellular localization of Flag-SMURF2 or Flag-SMURF2 NLS−Mut ; nuclei were stained with DAPI (Bottom). (M) HEK293T cells were first transfected with HA-NRF2-WT. Subsequently, cells were transfected either with Flag or Flag-SMURF2 NLS−Mut , then treated with H 2 O 2 (200 μM, 2 h) or LPS (100 ng/mL, 12 h). Following treatment, subcellular fractionation was performed to isolate total, nuclear, and cytoplasmic proteins, followed by western blot analysis with indicated antibodies. (N) The proposed model indicates that SMURF2 specifically degrades NRF2 in the nucleus. Scale bar: 5 μm, Scale bar: 10 μm. Data were presented in three independent experiments.

    Article Snippet: The human glioblastoma cell lines LN229 and human embryonic kidney 293T (HEK293T) cell lines were purchased from the American Type Culture Collection (ATCC).

    Techniques: Translocation Assay, Transfection, Fractionation, Western Blot, Staining

    SMURF2 ubiquitinates NRF2 at K555 in the nucleus for its degradation. (A) HEK293T cells were transfected with HA-NRF2 constructs (ΔNeh1-ΔNeh6), followed by treatment with MG132 (10 μM, 12 h). The ubiquitination of HA-NRF2 constructs (ΔNeh1-ΔNeh6) in the presence of purified GST or GST-SMURF2 was then detected by western blotting. (B) HEK293T cells were transfected with HA-NRF2 constructs (Δ434-500, Δ501-539 and Δ540-561), followed by treatment with MG132 (10 μM, 12 h). The ubiquitination of HA-NRF2 constructs (Δ434-500, Δ501-539 and Δ540-561) in the presence of purified GST or GST-SMURF2 was then detected by western blotting. (C) HEK293T cells were transfected with HA-NRF2 constructs (K554R/K555R and K541R/K543R/K548R), followed by treatment with MG132 (10 μM, 12 h). The ubiquitination of HA-NRF2 constructs (K554R/K555R and K541R/K543R/K548R) in the presence of purified GST or GST-SMURF2 was then detected by western blotting. (D) HEK293T cells were transfected with HA-NRF2 constructs (K554R and K555R), followed by treatment with MG132 (10 μM, 12 h). The ubiquitination of HA-NRF2 constructs (K554R and K555R) in the presence of purified GST or GST-SMURF2 was then detected by western blotting. (E) Purified SMURF2 with His-ub, E1, E2 (UbcH5c), and ATP were used as indicated and evaluated by pull-down assay. Ubiquitinated NRF2-WT and K555R detected by immunoblotting against anti-Ub and anti-Flag. (F) Sequence alignment of NRF2 sites on CNA orthologs of different species. (G) HEK293T cells overexpressing HA-NRF2 were transfected with Flag or Flag-SMURF2, followed by treatment with MG132 (10 μM, 12 h). Following treatment, subcellular fractionation was performed to isolate cytoplasmic and nuclear fractions. The ubiquitination of cytoplasmic and nuclear fractions was then detected by western blotting. (H) HEK293T cells were transfected with HA-NRF2 NLS1−Mut , HA-NRF2 NES1−Mut , HA-NRF2 NLS2−Mut or HA-NRF2 NES2−Mut , followed by treatment with MG132 (10 μM, 12 h). The ubiquitination of HA-NRF2 constructs in the presence of purified GST or GST-SMURF2 was then detected by western blotting. (I and J) HEK293T cells were first transfected with HA-NRF2 (I), or HA-NRF2-K555R (J), then were transfected with Flag or Flag-SMURF2, followed by treatment with MG132 (10 μM, 12 h) (I), H 2 O 2 (200 μM, 2 h) or LPS (100 ng/mL, 12 h) (J). Following treatment, subcellular fractionation was performed to isolate total, nuclear, and cytoplasmic proteins, followed by western blot analysis with indicated antibodies. Data were presented in three independent experiments.

    Journal: Redox Biology

    Article Title: SMURF2 attenuates NRF2-driven tumor progression by acting as a nuclear brake on NRF2 during cellular stress

    doi: 10.1016/j.redox.2026.104102

    Figure Lengend Snippet: SMURF2 ubiquitinates NRF2 at K555 in the nucleus for its degradation. (A) HEK293T cells were transfected with HA-NRF2 constructs (ΔNeh1-ΔNeh6), followed by treatment with MG132 (10 μM, 12 h). The ubiquitination of HA-NRF2 constructs (ΔNeh1-ΔNeh6) in the presence of purified GST or GST-SMURF2 was then detected by western blotting. (B) HEK293T cells were transfected with HA-NRF2 constructs (Δ434-500, Δ501-539 and Δ540-561), followed by treatment with MG132 (10 μM, 12 h). The ubiquitination of HA-NRF2 constructs (Δ434-500, Δ501-539 and Δ540-561) in the presence of purified GST or GST-SMURF2 was then detected by western blotting. (C) HEK293T cells were transfected with HA-NRF2 constructs (K554R/K555R and K541R/K543R/K548R), followed by treatment with MG132 (10 μM, 12 h). The ubiquitination of HA-NRF2 constructs (K554R/K555R and K541R/K543R/K548R) in the presence of purified GST or GST-SMURF2 was then detected by western blotting. (D) HEK293T cells were transfected with HA-NRF2 constructs (K554R and K555R), followed by treatment with MG132 (10 μM, 12 h). The ubiquitination of HA-NRF2 constructs (K554R and K555R) in the presence of purified GST or GST-SMURF2 was then detected by western blotting. (E) Purified SMURF2 with His-ub, E1, E2 (UbcH5c), and ATP were used as indicated and evaluated by pull-down assay. Ubiquitinated NRF2-WT and K555R detected by immunoblotting against anti-Ub and anti-Flag. (F) Sequence alignment of NRF2 sites on CNA orthologs of different species. (G) HEK293T cells overexpressing HA-NRF2 were transfected with Flag or Flag-SMURF2, followed by treatment with MG132 (10 μM, 12 h). Following treatment, subcellular fractionation was performed to isolate cytoplasmic and nuclear fractions. The ubiquitination of cytoplasmic and nuclear fractions was then detected by western blotting. (H) HEK293T cells were transfected with HA-NRF2 NLS1−Mut , HA-NRF2 NES1−Mut , HA-NRF2 NLS2−Mut or HA-NRF2 NES2−Mut , followed by treatment with MG132 (10 μM, 12 h). The ubiquitination of HA-NRF2 constructs in the presence of purified GST or GST-SMURF2 was then detected by western blotting. (I and J) HEK293T cells were first transfected with HA-NRF2 (I), or HA-NRF2-K555R (J), then were transfected with Flag or Flag-SMURF2, followed by treatment with MG132 (10 μM, 12 h) (I), H 2 O 2 (200 μM, 2 h) or LPS (100 ng/mL, 12 h) (J). Following treatment, subcellular fractionation was performed to isolate total, nuclear, and cytoplasmic proteins, followed by western blot analysis with indicated antibodies. Data were presented in three independent experiments.

    Article Snippet: The human glioblastoma cell lines LN229 and human embryonic kidney 293T (HEK293T) cell lines were purchased from the American Type Culture Collection (ATCC).

    Techniques: Transfection, Construct, Ubiquitin Proteomics, Purification, Western Blot, Pull Down Assay, Sequencing, Fractionation

    SMURF2 promotes cell apoptosis through NRF2 inactivation. (A) LN229 cells were transfected with HA, HA-SMURF2, Myc-NRF2 or HA-SMURF2 + Myc-NRF2 and subsequent treatment with MG132 (10 μM, 12 h), H 2 O 2 (200 μM, 2 h), or LPS (100 ng/mL, 12 h). Representative IF images of the colocalization of ub and p62. Nuclei stained with DAPI. (B and C) HEK293T cells were transfected with empty vector or Myc-NRF2, followed by Flag or Flag-SMURF2 expression. Western blotting was performed using indicated antibodies (B). qRT-PCR was performed using primers specific for indicated genes (C). The fold change in expression in Flag-SMURF2 overexpressing samples was calculated relative to control samples. (D) HEK293T cells were first transfected with NRF2 siRNA for 48 h, followed by transfection with either Myc-NRF2-WT or Myc-NRF2-K555R, and subsequently transfected with Flag or Flag-SMURF2.Western blotting was performed using indicated antibodies. (E) LN229 cells were transfected with SMURF2 siRNA or scramble siRNA oligos for 48 h, followed by treatment with PBS or H 2 O 2 (200 μM, 2 h). Cells were then stained with 2,7-Dichlorodihydrofluorescein diacetate (DCFH-DA, 10 μM) and the ROS level was detected by flow cytometry. (F) Quantification of relative ROS fluorescence intensity in LN229 cells with SMURF2 knockdown or HA-SMURF2 overexpression. (G and H) LN229 cells were transfected with SMURF2 siRNA or scramble siRNA oligos for 48 h or transfected with HA or HA-SMURF2, followed by treatment with PBS or H 2 O 2 (200 μM, 2 h). Cells were then stained with Annexin-V/propidium iodide (PI), and apoptotic cells were detected by flow cytometry (G). Quantification of apoptosis in LN229 cells with SMURF2 knockdown or HA-SMURF2 overexpression (H). (I) HEK293T cells were transfection with Flag or Flag-SMURF2, and subsequent treatment with or without MG132 (10 μM, 12 h), H 2 O 2 (200 μM, 2 h), or LPS (100 ng/ml, 12 h). Western blotting was performed using indicated antibodies. (J and K) HEK293T cells were transfected with empty vector and Myc-NRF2 (J) or Myc-NRF2-WT, Myc-NRF2-K555R (K), followed by Flag or Flag-SMURF2 expression. Cells were subsequently treated with MG132 (10 μM, 12 h), H 2 O 2 (200 μM, 2 h), or LPS (100 ng/mL, 12 h). Western blotting was performed using indicated antibodies. (L) The shSMURF2 and shPLKO cells were treated with or without LPS (100 ng/mL, 12 h) and cultured for 14 days. Colony formation assay was performed for cells. (M) The representative images of shSMURF2 and shPLKO patient-derived cells formed tumors in nude mice with or without LPS (10 mg/kg). (N) The graph showed the quantified data of tumor weight. (O) Immunohistochemistry (IHC) analysis of tumor tissue slides with antibodies against Ki67. Nucleus was stained by hematoxylin. Scale bar, 50 μm (P) The proposed model indicates that SMURF2 promotes cell apoptosis through NRF2 inactivation. Data were presented as the mean ± SD from three independent experiments. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001. Scale bar: 10 μm, Scale bar, 50 μm.

    Journal: Redox Biology

    Article Title: SMURF2 attenuates NRF2-driven tumor progression by acting as a nuclear brake on NRF2 during cellular stress

    doi: 10.1016/j.redox.2026.104102

    Figure Lengend Snippet: SMURF2 promotes cell apoptosis through NRF2 inactivation. (A) LN229 cells were transfected with HA, HA-SMURF2, Myc-NRF2 or HA-SMURF2 + Myc-NRF2 and subsequent treatment with MG132 (10 μM, 12 h), H 2 O 2 (200 μM, 2 h), or LPS (100 ng/mL, 12 h). Representative IF images of the colocalization of ub and p62. Nuclei stained with DAPI. (B and C) HEK293T cells were transfected with empty vector or Myc-NRF2, followed by Flag or Flag-SMURF2 expression. Western blotting was performed using indicated antibodies (B). qRT-PCR was performed using primers specific for indicated genes (C). The fold change in expression in Flag-SMURF2 overexpressing samples was calculated relative to control samples. (D) HEK293T cells were first transfected with NRF2 siRNA for 48 h, followed by transfection with either Myc-NRF2-WT or Myc-NRF2-K555R, and subsequently transfected with Flag or Flag-SMURF2.Western blotting was performed using indicated antibodies. (E) LN229 cells were transfected with SMURF2 siRNA or scramble siRNA oligos for 48 h, followed by treatment with PBS or H 2 O 2 (200 μM, 2 h). Cells were then stained with 2,7-Dichlorodihydrofluorescein diacetate (DCFH-DA, 10 μM) and the ROS level was detected by flow cytometry. (F) Quantification of relative ROS fluorescence intensity in LN229 cells with SMURF2 knockdown or HA-SMURF2 overexpression. (G and H) LN229 cells were transfected with SMURF2 siRNA or scramble siRNA oligos for 48 h or transfected with HA or HA-SMURF2, followed by treatment with PBS or H 2 O 2 (200 μM, 2 h). Cells were then stained with Annexin-V/propidium iodide (PI), and apoptotic cells were detected by flow cytometry (G). Quantification of apoptosis in LN229 cells with SMURF2 knockdown or HA-SMURF2 overexpression (H). (I) HEK293T cells were transfection with Flag or Flag-SMURF2, and subsequent treatment with or without MG132 (10 μM, 12 h), H 2 O 2 (200 μM, 2 h), or LPS (100 ng/ml, 12 h). Western blotting was performed using indicated antibodies. (J and K) HEK293T cells were transfected with empty vector and Myc-NRF2 (J) or Myc-NRF2-WT, Myc-NRF2-K555R (K), followed by Flag or Flag-SMURF2 expression. Cells were subsequently treated with MG132 (10 μM, 12 h), H 2 O 2 (200 μM, 2 h), or LPS (100 ng/mL, 12 h). Western blotting was performed using indicated antibodies. (L) The shSMURF2 and shPLKO cells were treated with or without LPS (100 ng/mL, 12 h) and cultured for 14 days. Colony formation assay was performed for cells. (M) The representative images of shSMURF2 and shPLKO patient-derived cells formed tumors in nude mice with or without LPS (10 mg/kg). (N) The graph showed the quantified data of tumor weight. (O) Immunohistochemistry (IHC) analysis of tumor tissue slides with antibodies against Ki67. Nucleus was stained by hematoxylin. Scale bar, 50 μm (P) The proposed model indicates that SMURF2 promotes cell apoptosis through NRF2 inactivation. Data were presented as the mean ± SD from three independent experiments. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001. Scale bar: 10 μm, Scale bar, 50 μm.

    Article Snippet: The human glioblastoma cell lines LN229 and human embryonic kidney 293T (HEK293T) cell lines were purchased from the American Type Culture Collection (ATCC).

    Techniques: Transfection, Staining, Plasmid Preparation, Expressing, Western Blot, Quantitative RT-PCR, Control, Flow Cytometry, Fluorescence, Knockdown, Over Expression, Cell Culture, Colony Assay, Derivative Assay, Immunohistochemistry

    SMURF2 promotes NRF2 hi patient survival. (A) HA-NRF2 overexpressing HEK293T cells were transfected with GFP or GFP-KEAP1, followed by transfection with Flag or Flag-SMURF2. Co-IP analysis of the interaction between HA-NRF2 and GFP-KEAP1 in WCL. (B) Myc-NRF2 overexpressing HEK293T cells were transfected with HA or HA-KEAP1, followed by transfection with Flag or Flag-SMURF2. Co-IP analysis of the interaction between Myc-NRF2 and HA-KEAP1 in the cytoplasm. (C) HA-NRF2 overexpressing HEK293T cells were transfected with GFP or GFP-KEAP1, followed by transfection with SMURF2 siRNA or scramble siRNA oligos for 48 h. Co-IP analysis of the interaction between HA-NRF2 and GFP-KEAP1 in the cytoplasm under with or without SMURF2. (D) HEK293T cells were initially transfected with KEAP1 siRNA for 48 h, followed by transfection with HA-NRF2-WT, and subsequently transfected with Flag or Flag-SMURF2. Subcellular fractionation was performed to isolate total, nuclear, and cytoplasmic proteins, followed by western blot analysis with indicated antibodies. (E) HEK293T cells were first transfected with HA-NRF2-WT. Subsequently, cells were transfected either with Flag or Flag-KEAP1. Subcellular fractionation was performed to isolate total, nuclear, and cytoplasmic proteins, followed by western blot analysis with indicated antibodies. (F) GFP-KEAP1 overexpression HEK293T cells were transfected with HA-NRF2-WT, and subsequently transfected with Flag or Flag-SMURF2. Subcellular fractionation was performed to isolate total, nuclear, and cytoplasmic proteins, followed by western blot analysis with indicated antibodies. (G) Co-IP assay analysis of the interaction between HA-KEAP1 and His-Flag-NRF2 after treated with or without H 2 O 2 (200 μM, 2 h) (H) Boxplot of SMURF2 expression (log 2 FPKM) in the NRF2-high/KEAP1-low subset of TCGA-GBMLGG samples. (I) Kaplan-Meier survival analysis of TCGA-GBMLGG patients grouped by expression of SMURF2 in the NRF2-high/KEAP1-low subset ( p = 0.018, HR = 1.7755, log rank test). (J) Clinical feature distribution across SMURF2 expression groups. (K) Forest Plot of Multivariable Cox Proportional Hazards Analysis in High-Grade Gliomas. Data were presented in three independent experiments. ∗∗ p < 0.01; ∗∗∗ p < 0.001.

    Journal: Redox Biology

    Article Title: SMURF2 attenuates NRF2-driven tumor progression by acting as a nuclear brake on NRF2 during cellular stress

    doi: 10.1016/j.redox.2026.104102

    Figure Lengend Snippet: SMURF2 promotes NRF2 hi patient survival. (A) HA-NRF2 overexpressing HEK293T cells were transfected with GFP or GFP-KEAP1, followed by transfection with Flag or Flag-SMURF2. Co-IP analysis of the interaction between HA-NRF2 and GFP-KEAP1 in WCL. (B) Myc-NRF2 overexpressing HEK293T cells were transfected with HA or HA-KEAP1, followed by transfection with Flag or Flag-SMURF2. Co-IP analysis of the interaction between Myc-NRF2 and HA-KEAP1 in the cytoplasm. (C) HA-NRF2 overexpressing HEK293T cells were transfected with GFP or GFP-KEAP1, followed by transfection with SMURF2 siRNA or scramble siRNA oligos for 48 h. Co-IP analysis of the interaction between HA-NRF2 and GFP-KEAP1 in the cytoplasm under with or without SMURF2. (D) HEK293T cells were initially transfected with KEAP1 siRNA for 48 h, followed by transfection with HA-NRF2-WT, and subsequently transfected with Flag or Flag-SMURF2. Subcellular fractionation was performed to isolate total, nuclear, and cytoplasmic proteins, followed by western blot analysis with indicated antibodies. (E) HEK293T cells were first transfected with HA-NRF2-WT. Subsequently, cells were transfected either with Flag or Flag-KEAP1. Subcellular fractionation was performed to isolate total, nuclear, and cytoplasmic proteins, followed by western blot analysis with indicated antibodies. (F) GFP-KEAP1 overexpression HEK293T cells were transfected with HA-NRF2-WT, and subsequently transfected with Flag or Flag-SMURF2. Subcellular fractionation was performed to isolate total, nuclear, and cytoplasmic proteins, followed by western blot analysis with indicated antibodies. (G) Co-IP assay analysis of the interaction between HA-KEAP1 and His-Flag-NRF2 after treated with or without H 2 O 2 (200 μM, 2 h) (H) Boxplot of SMURF2 expression (log 2 FPKM) in the NRF2-high/KEAP1-low subset of TCGA-GBMLGG samples. (I) Kaplan-Meier survival analysis of TCGA-GBMLGG patients grouped by expression of SMURF2 in the NRF2-high/KEAP1-low subset ( p = 0.018, HR = 1.7755, log rank test). (J) Clinical feature distribution across SMURF2 expression groups. (K) Forest Plot of Multivariable Cox Proportional Hazards Analysis in High-Grade Gliomas. Data were presented in three independent experiments. ∗∗ p < 0.01; ∗∗∗ p < 0.001.

    Article Snippet: The human glioblastoma cell lines LN229 and human embryonic kidney 293T (HEK293T) cell lines were purchased from the American Type Culture Collection (ATCC).

    Techniques: Transfection, Co-Immunoprecipitation Assay, Fractionation, Western Blot, Over Expression, Expressing

    The DRL shows neurodevelopmental enhancer activity (A) Schematic representation of the DRL/FragT sequence in DAB1 -antisense strand. The zoom-in box (pale brown box) shows the (AAAAT) n (blue box) in the middle A-rich region of the AluJb element with left (LM) and right (RM) monomers, close to the CpG island (yellow box) and the TFBS (green box), flanked by CTCF-binding sites. The ENCODE-annotated regulatory EH38E1350977 element is represented in pink. Lines underneath represent the sequences cloned for the zebrafish transgenic lines generation, across and within the DRL sequence. (B) Stereomicroscopic images of EGFP expression in the eye and whole brain, at 24 hpf, in transgenic lines with FragT14-AS and Frag3-AS sequences cloned upstream of a promoter-less EGFP; no expression is seen in control embryos; images were processed with the Fiji software. (C) Left: representative confocal images confirming FragT14-AS and Frag3-AS expression in the eye, forebrain, midbrain, and hindbrain in these zebrafish transgenic lines at 24 hpf; maximum intensity z-projections of 14 planes; scale bars: 100 μm. Right: zoom-in images for the same zebrafish lines; orange and yellow delimitations represent eye and midbrain-hindbrain boundary close-ups, respectively; scale bars: 100 μm. (D) Left: schematic representation of the DRL sequences cloned upstream of promoter-less firefly luciferase ( luc+ ) for reporter assays in human HEK293T cells. Right: graphic representation of luciferase activity (fold change) for each sequence, as luc+/NanoLuc (Nluc) expression ratios in HEK293T cells, compared to the negative control (data are from three biological replicates, shown as the mean ± SD; one-way ANOVA test with Dunnett’s post hoc test; ∗∗∗∗ p < 0.0001 and ∗∗∗ p < 0.001). FB, forebrain; MB, midbrain; HD, hindbrain; OV, optic vesicle; MA, mutant allele; scale bars: 100 μm. Asterisks represent autofluorescence regions. See also .

    Journal: Cell Reports

    Article Title: The insertion of an ATTTC repeat in an Alu element hyperactivates a neurodevelopmental enhancer in spinocerebellar ataxia type 37

    doi: 10.1016/j.celrep.2026.117146

    Figure Lengend Snippet: The DRL shows neurodevelopmental enhancer activity (A) Schematic representation of the DRL/FragT sequence in DAB1 -antisense strand. The zoom-in box (pale brown box) shows the (AAAAT) n (blue box) in the middle A-rich region of the AluJb element with left (LM) and right (RM) monomers, close to the CpG island (yellow box) and the TFBS (green box), flanked by CTCF-binding sites. The ENCODE-annotated regulatory EH38E1350977 element is represented in pink. Lines underneath represent the sequences cloned for the zebrafish transgenic lines generation, across and within the DRL sequence. (B) Stereomicroscopic images of EGFP expression in the eye and whole brain, at 24 hpf, in transgenic lines with FragT14-AS and Frag3-AS sequences cloned upstream of a promoter-less EGFP; no expression is seen in control embryos; images were processed with the Fiji software. (C) Left: representative confocal images confirming FragT14-AS and Frag3-AS expression in the eye, forebrain, midbrain, and hindbrain in these zebrafish transgenic lines at 24 hpf; maximum intensity z-projections of 14 planes; scale bars: 100 μm. Right: zoom-in images for the same zebrafish lines; orange and yellow delimitations represent eye and midbrain-hindbrain boundary close-ups, respectively; scale bars: 100 μm. (D) Left: schematic representation of the DRL sequences cloned upstream of promoter-less firefly luciferase ( luc+ ) for reporter assays in human HEK293T cells. Right: graphic representation of luciferase activity (fold change) for each sequence, as luc+/NanoLuc (Nluc) expression ratios in HEK293T cells, compared to the negative control (data are from three biological replicates, shown as the mean ± SD; one-way ANOVA test with Dunnett’s post hoc test; ∗∗∗∗ p < 0.0001 and ∗∗∗ p < 0.001). FB, forebrain; MB, midbrain; HD, hindbrain; OV, optic vesicle; MA, mutant allele; scale bars: 100 μm. Asterisks represent autofluorescence regions. See also .

    Article Snippet: Human embryonic kidney 293T (HEK293T) cell line , ATCC , Cat #CRL-3216.

    Techniques: Activity Assay, Sequencing, Binding Assay, Clone Assay, Transgenic Assay, Expressing, Control, Software, Luciferase, Negative Control, Mutagenesis

    DRL interaction with neural regulatory elements and silencer activity outside of the DAB1 expression domain (A) Schematics of interactions between the DRL sequence and the zebrafish midbrain-specific Z48 enhancer at 48 hpf. Top: FragT14-AS, Frag1-AS, and Frag3-AS sequences cloned upstream of a promoter-less EGFP and Z48 with schematics of their driven EGFP expression to zebrafish somites and upon Z48 interaction only to the whole midbrain. Bottom left: representative stereomicroscopic images of different EGFP expression patterns in the midbrain from FragT14-AS, Frag1-AS, and Frag3-AS interactions with the Z48 enhancer in embryos. Bottom right: graphic representation of the percentage of embryos expressing EGFP in midbrain and/or somites (shown as the mean ± SD of three replicates; EGFP-positive embryos, FragT14-AS = 238, Frag1-AS = 195, and Frag3-AS = 148, ꭕ 2 , ∗∗∗∗ p < 0.0001). (B) Left: schematic representation of the DRL sequences cloned upstream the TK promoter in the control of luciferase expression for silencer assay in HEK293T cells; right: luciferase activity in HEK293T cells, measured by the fold change in luciferase/NanoLuc (luc2/Nluc) expression ratios compared to the negative control (shown as the mean ± SD of three biological replicates; one-way ANOVA test with Dunnett’s post hoc test; ∗∗∗∗ p < 0.0001 and ∗∗∗ p < 0.001). (C) Silencer activity of the DRL in vivo . Top: schematics of the putative silencer placed between the Z48 enhancer and the cardiac actin promoter in the reporter vector. Intermediate: graphical representation showing EGFP fluorescence intensity signal in midbrain and somites triggered by (left) FragT14-S and FragT-S-MA and (right) Frag1-S and Frag3-S sequences at 24 hpf; negative control, empty vector (data are represented as the mean ± SD; n = 60 zebrafish embryos/condition from three replicates, Kruskal-Wallis test followed by Dunn’s post hoc test; ∗∗∗∗ p < 0.0001, ∗∗∗ p < 0.001, and ∗ p < 0.05). Bottom: representative stereomicroscopic images of EGFP expression in zebrafish midbrain and somites driven by FragT14-S, FragT-S-MA, Frag1-S, and Frag3-S putative silencer elements; scale bars: 200 μm; arrows indicate EGFP expression in midbrain. MA, mutant allele. Asterisks show the area of autofluorescence. See also .

    Journal: Cell Reports

    Article Title: The insertion of an ATTTC repeat in an Alu element hyperactivates a neurodevelopmental enhancer in spinocerebellar ataxia type 37

    doi: 10.1016/j.celrep.2026.117146

    Figure Lengend Snippet: DRL interaction with neural regulatory elements and silencer activity outside of the DAB1 expression domain (A) Schematics of interactions between the DRL sequence and the zebrafish midbrain-specific Z48 enhancer at 48 hpf. Top: FragT14-AS, Frag1-AS, and Frag3-AS sequences cloned upstream of a promoter-less EGFP and Z48 with schematics of their driven EGFP expression to zebrafish somites and upon Z48 interaction only to the whole midbrain. Bottom left: representative stereomicroscopic images of different EGFP expression patterns in the midbrain from FragT14-AS, Frag1-AS, and Frag3-AS interactions with the Z48 enhancer in embryos. Bottom right: graphic representation of the percentage of embryos expressing EGFP in midbrain and/or somites (shown as the mean ± SD of three replicates; EGFP-positive embryos, FragT14-AS = 238, Frag1-AS = 195, and Frag3-AS = 148, ꭕ 2 , ∗∗∗∗ p < 0.0001). (B) Left: schematic representation of the DRL sequences cloned upstream the TK promoter in the control of luciferase expression for silencer assay in HEK293T cells; right: luciferase activity in HEK293T cells, measured by the fold change in luciferase/NanoLuc (luc2/Nluc) expression ratios compared to the negative control (shown as the mean ± SD of three biological replicates; one-way ANOVA test with Dunnett’s post hoc test; ∗∗∗∗ p < 0.0001 and ∗∗∗ p < 0.001). (C) Silencer activity of the DRL in vivo . Top: schematics of the putative silencer placed between the Z48 enhancer and the cardiac actin promoter in the reporter vector. Intermediate: graphical representation showing EGFP fluorescence intensity signal in midbrain and somites triggered by (left) FragT14-S and FragT-S-MA and (right) Frag1-S and Frag3-S sequences at 24 hpf; negative control, empty vector (data are represented as the mean ± SD; n = 60 zebrafish embryos/condition from three replicates, Kruskal-Wallis test followed by Dunn’s post hoc test; ∗∗∗∗ p < 0.0001, ∗∗∗ p < 0.001, and ∗ p < 0.05). Bottom: representative stereomicroscopic images of EGFP expression in zebrafish midbrain and somites driven by FragT14-S, FragT-S-MA, Frag1-S, and Frag3-S putative silencer elements; scale bars: 200 μm; arrows indicate EGFP expression in midbrain. MA, mutant allele. Asterisks show the area of autofluorescence. See also .

    Article Snippet: Human embryonic kidney 293T (HEK293T) cell line , ATCC , Cat #CRL-3216.

    Techniques: Activity Assay, Expressing, Sequencing, Clone Assay, Control, Luciferase, Negative Control, In Vivo, Plasmid Preparation, Fluorescence, Mutagenesis